Take a journey throughout my experience and what I have learned throughout the 1st Unit in Genetics

Enjoy!

Genetic Code

There are 4 Nitrogenous bases in DNA:

-Adenine

-Cystosine

-Thymine

-Guanine

When an original DNA strand forms a complement strand, the 4 nitrogenous bases pair up with each other.

Adenine pairs with Thymine

Cytosine pairs with Guanine

Genetic Code

Each nitrogenous base in DNA (A, T, C, G) is connected with a pentose sugar, and a phosphate group to create a nucleotide which is the structure of DNA.

Adenine and Guanine are purines (2-ring structure)

Cytosine and Thymine are pyrimidines (single ring structure)

Genetic Code

For RNA, the nitrogenous bases are Adenine, Cytosine, Guanine, and Uracil.

DNA is double stranded and RNA is single stranded because with the oxygen taken out in the molecular formula on the pentose sugar is more stable to form a double helix. RNA has a ribose sugar instead of a deoxyribose sugar making it more unstable to create a double helix.

Genetic Code

During the activity, I used my knowledge of base pairing rules to take my sequence from 5' to 3' and create a compliment strand going from 3' to 5'.

My Sequence:

5’ GGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTG 3'

Compliment Sequence:

3’ CCTGTCTCCTGTTACCGAAGGTACGTTAACCCGTCTACACACTCCGTGGAC 5'                                                                                                                                                                            

DNA

DNA molecules contain genetic code that dictates cell activity and developments in nearly all living things.

-DNA is coiled up into chromosomes inside the nucleus.

-Every cell has 46 chromosomes (aside from reproductive cells), or 23 chromosome pairs.



-DNA is unique because no two people share the exact same DNA.

-DNA copies information and also stores it.

DNA

DNA goes through replication to copy a cell's entire DNA. It's job is to zip along the strand and take apart the hydrogen bonds.

What is needed to replicate DNA and what are their jobs?

-Helicase is needed to unzip the DNA

-DNA Polymerase III adds DNA bases to the complimentary strand

-Primase attaches RNA bases called Ogazaki fragments

-DNA Polymerase I takes out RNA bases and replaces them with DNA bases

-Ligase links the DNA strand and closes the gaps

DNA is a semi-conservative model

RNA

3 Types of RNA:

mRNA (messenger RNA): Carries genetic code from DNA to the ribosome. Uses A, G, U, and C nitrogenous bases.

tRNA (transfer RNA): key to read the code on mRNA. WIth the amino acid chain (polypeptide chain), tRNA is used to decode mRNA into a protein.

rRNA (ribosomal RNA): links the amino acids together and reads them.

-RNA is unique because it is single-stranded

-Instead of using a deoxyribose sugar, RNA contains a ribose sugar

RNA

In the activity I used my knowledge of the different types of RNA and translated my compliment sequence as seen on page 6, into mRNA for transcription.

Sequence:

5’GGACAGAGGACAATGGCTTCCATGCAATTGGGCAGATGTGTGAGGCACCTG 3'                                                                                                    Transcript:

5’GGACAGAGGACAAUGGCUUCCAUGCAAUUGGGCAGAUGUGUGAGGCAC 3'                                                                                                                                                                          

DNA & RNA

Transcription

Transcription Process:

initiation: RNA Polymerase attaches to DNA and the codon AUG is found

elongation: The polypeptide chain grows as the ribosome is moving along the mRNA

termination: Polymerase detaches when a release factor brings a water molecule to the ribosome and the polyadenylation is made

A promoter starts the transcription process of a certain gene. The TATA box is a sequence of DNA found in the core promoter region that identifies where a genetic sequence can be decoded and also read.

Transcription

Enzymes in Transcription:

Splicesomes: Takes out the introns before translation.

Ligase: Connects splice sites back together.

Aminoacyl-tRNA synthetase: Brings together a tRNA and an amino acid.

RNA Polymerase: Takes apart DNA so that RNA nucleotides can start adding onto the original DNA strand.

Transcription

When I did the activity, I took the top strand of my DNA sequence and from there, typed the sequence but instead of using thymine as one of the nitrogeneous bases, I used uracil since it is mRNA.

Translation

-The location of Translation happens in the ribosome, whereas Transcription happens in the nucleus.

-The purpose of translation is to translate the mRNA sequence from transcription, and form an amino acid sequence or polypeptide chain during protein synthesis.

Translation

Initiation: The ribosome connects to the mRNA at a specific site

Elongation: The ribosome goes along the mRNA and reads the codons

Termination: The ribosome reaches a stop codon signaling termination.

A codon is a group of 3 nucleotides

An anticodon is compatible with a complementary codon in mRNA

Translation

-tRNA molecules are 80 nucleotides long

-In the ribosome, there is a...

P site: the peptide comes

A site: the peptide is attached

E site: the tRNAs exit

I used my knowledge of translation during the activity and from the mRNA, I used the codon chart and paired the anticodon with an amino acid that continued to grow into a polypeptide chain.